Información

¿Cómo modelar computacionalmente la tarea de clasificación de tarjetas de Wisconsin?

¿Cómo modelar computacionalmente la tarea de clasificación de tarjetas de Wisconsin?

La tarea de clasificación de tarjetas de Wisconsin es bastante famosa, pero parece bastante difícil de modelar computacionalmente.

Trabajo en RL y me interesa cómo las personas aprenden la estrategia óptima. Me interesa la tarea porque permitiría una serie de manipulaciones experimentales. Quiero capturar el papel de memoria en la estrategia óptima. Las personas pueden realizar un seguimiento de algunos, pero no muchos, antecedentes de pruebas al realizar la tarea. (Es decir, la estrategia matemáticamente óptima parece demasiado pesada desde el punto de vista computacional).

  • ¿Cómo podría abordar el modelado de la tarea de clasificación de tarjetas de Wisconsin?
  • ¿Qué otra investigación ha modelado la tarea?

Dehaene y Changeux (1991) hicieron un modelo de red neuronal:

Las unidades de codificación son grupos de neuronas organizadas en capas o conjuntos. Un bucle sensonmotor permite a la red clasificar las tarjetas de entrada de acuerdo con varios criterios (color, forma, etc.). Un conjunto de alto nivel de códigos de clústeres de codificación de reglas para la regla actualmente probada, que cambia cuando se recibe una recompensa negativa. La prueba interna de las posibles reglas, análoga a un proceso de razonamiento, también se produce, mediante un ciclo de autoevaluación endógeno. Cuando está lesionado, el modelo reproduce el comportamiento de los pacientes con lóbulo frontal.

Parks y col. (1992) ampliaron los modelos neuronales anteriores de WCST para tener en cuenta la fluidez verbal.

Amos (2000) construyó un modelo de red neuronal que ayuda a distinguir entre el tipo de errores cometidos por pacientes con esquizofrenia, enfermedad de Parkinson y enfermedad de Huntington. Relaciona el modelo con la neuroanatomía y dice:

El modelo también hizo predicciones específicas, empíricamente falsables que pueden usarse para explorar la utilidad de estos supuestos mecanismos de procesamiento de información en la corteza frontal y los ganglios basales.

Monchi y col. (2000) siguió un enfoque similar al de Amos. Su modelo sugirió diferentes deficiencias en la enfermedad de Parkinson y los pacientes esquizofrénicos, e hizo predicciones específicas de lo que se observaría en las exploraciones de resonancia magnética funcional. Probaron esta predicción en su artículo.

En 2005, el WCST se había convertido en un punto de referencia para los modelos más generales. Rougier y col. (2005) hicieron un modelo general de la corteza prefrontal basado en principios neurobiológicos generales en contraposición a enfoques simbólicos. Modelan lo aprendido de la experiencia y se generalizan a tareas novedosas. Lo probaron en WCST y en los datos de tareas de Stroop para sujetos típicos y con daño frontal.

Kaplan y col. (2006) utilizan un enfoque de red neuronal con dos partes: una red de Hopfield sirve como memoria de trabajo y un bloque de Hamming como generador de hipótesis.

Bishara y col. (2010) utilizan un modelo más parecido a ACT-R (aunque no ACT-R real) con carga probabilística en reglas simbólicas. El modelo de aprendizaje secuencial resultante se utiliza para identificar procesos específicos con los que los sujetos podrían estar luchando. Se supone que ayuda al diagnóstico en un entorno clínico y lo prueban en individuos dependientes de sustancias.

Rigotti y col. (2010) crearon una red de neuronas conectadas aleatoriamente que podrían resolver la tarea. El punto clave fue que las conexiones aleatorias inducían una selectividad mixta, lo que resolvería la tarea con alta probabilidad.


Mis colegas han aplicado el modelo COVIS de aprendizaje por categorías al WCST. COVIS no es un modelo de rendimiento WCST per se, pero puede explicar varios fenómenos conocidos. Vea esta búsqueda de Google Académico: http://scholar.google.com/scholar?hl=en&q=Helie+Paul+ashby&btnG=&as_sdt=1%2C5&as_sdtp=


Representaciones de aprendizaje en un modelo de corteza prefrontal cerrada de cambio dinámico de tareas

Tel .: + 1-303-492-0054 fax: + 1-303-492-2967. Direcciones de correo electrónico: [email protected]

Departamento de Psicología, Universidad de Colorado Boulder, 345 UCB, Boulder, CO 80309-0345, EE. UU.

Tel .: + 1-303-492-0054 fax: + 1-303-492-2967. Direcciones de correo electrónico: [email protected]

Departamento de Psicología, Universidad de Colorado Boulder, 345 UCB, Boulder, CO 80309-0345, EE. UU.

Tel .: + 1-303-492-0054 fax: + 1-303-492-2967. Direcciones de correo electrónico: [email protected]

Departamento de Psicología, Universidad de Colorado Boulder, 345 UCB, Boulder, CO 80309-0345, EE. UU.

Tel .: + 1-303-492-0054 fax: + 1-303-492-2967. Direcciones de correo electrónico: [email protected]

Abstracto

Se cree ampliamente que la corteza prefrontal juega un papel importante en facilitar la capacidad de las personas para cambiar el desempeño entre diferentes tareas. Presentamos un modelo computacional de base biológica de la corteza prefrontal (PFC) que explica su papel en el cambio de tareas en términos de la mayor flexibilidad conferida por las representaciones de la memoria de trabajo basadas en la activación en PFC, en comparación con la adaptación más lenta de los mecanismos de memoria basados ​​en el peso. Específicamente, mostramos que las representaciones de PFC se pueden actualizar rápidamente cuando una tarea cambia a través de un mecanismo de activación dinámico basado en un mecanismo de aprendizaje de predicción de recompensa de diferencias temporales. A diferencia de los modelos anteriores de este tipo, el modelo actual desarrolla todas sus representaciones internas a través de mecanismos de aprendizaje, tal y como están moldeados por las demandas del cambio periódico continuo de tareas. Este avance abre un nuevo dominio de investigación sobre las interacciones entre las demandas de las tareas de la memoria de trabajo y las representaciones que se desarrollan para satisfacerlas. Los resultados de una versión de la tarea de clasificación de tarjetas de Wisconsin se presentan para el modelo completo y una serie de redes de comparación que prueban la importancia de varias características del modelo. Además, mostramos que un modelo lesionado produce errores perseverativos como los observados en pacientes frontales.


Discusión

Este estudio exploró el rendimiento de WCST como una medida de flexibilidad cognitiva, informando varios resultados en un gran conjunto de datos de controles sanos, recuperados y enfermos activamente recopilados de varios estudios realizados dentro de nuestro departamento. Los pacientes con AN y BN tuvieron un desempeño deficiente en casi todos los dominios de WCST. Los resultados mostraron que en términos de flexibilidad (errores perseverativos), no hubo diferencia significativa entre pacientes hospitalizados y ambulatorios con anorexia, sino que los pacientes hospitalizados cometieron significativamente más errores no perseverativos, un hallazgo que puede reflejar problemas con la atención y un estado nutricional deficiente. Las personas con antecedentes de AN mostraron un mejor desempeño que los participantes activamente enfermos, sin embargo, los errores perseverantes, las respuestas de nivel conceptual y el número de categorías completadas (los principales resultados de flexibilidad) se vieron significativamente afectados en comparación con los participantes de HC. Sin embargo, los tamaños del efecto fueron menores entre los pacientes con HC y las personas con antecedentes de AN, lo que sugiere que la flexibilidad se puede mejorar en relación con el estado de enfermedad activa.

En general, nuestros resultados replican claramente los estudios que informan de una escasa flexibilidad cognitiva en la AN [4], [13], [14]. Este estudio amplía el conocimiento sobre el cambio de set en BN, mostrando que los pacientes con BN se desempeñan tan mal en el WCST como aquellos con AN. Las personas en una etapa de buena recuperación de la AN todavía tenían problemas con la perseverancia y el uso de la estrategia conceptual en esta tarea. Un informe reciente sobre un gran conjunto de datos similar que utiliza una medida diferente de cambio de set - la tarea de anticipación Brixton Special [15] - encontró que los pacientes con AN se desempeñaron significativamente peor que los grupos de participantes de HC y BN. Por el contrario, en el estudio actual, encontramos que ambos grupos de pacientes de urgencias activamente enfermos (AN y BN) tenían un peor desempeño en comparación con los CS y en algunos aspectos de las tareas (por ejemplo, respuestas perseverantes y nivel conceptual de respuestas), las personas que tenían recuperado también mostró un bajo rendimiento. Una posible explicación para este hallazgo podría ser que, aunque tanto la tarea de Brixton como la WCST miden la flexibilidad, difieren en términos de su complejidad. En la tarea de Brixton, a los participantes se les dice explícitamente que el principio de clasificación cambiará y, por lo tanto, están alertas a futuros cambios en las reglas. En el WCST, los participantes deben identificar la regla para poder responder correctamente, estando esta regla sujeta a modificaciones. Por lo tanto, el WCST puede implicar mayores niveles de ambigüedad, ya que, a diferencia de la tarea de Brixton, a los participantes no se les dice explícitamente que las reglas cambiarán a lo largo de la tarea. El WCST depende de operaciones cognitivas como buscar una nueva categoría y consolidar la categoría de clasificación correcta. Las tareas también difieren en cómo se proporciona la retroalimentación. Mientras que el WCST proporciona retroalimentación en la que se les dice a los participantes que están “en lo correcto” o “equivocado”, para la tarea de Brixton, la respuesta correcta designada se proporciona por definición cuando se muestra la siguiente matriz. Este tipo de retroalimentación es posiblemente menos pronunciado y requiere el proceso adicional de recordar la respuesta inmediatamente anterior y hacer coincidir la corrección. En resumen, las instrucciones son más explícitas en la tarea de Brixton y la retroalimentación es posiblemente más pronunciada en el WCST.

Por lo tanto, una explicación de este hallazgo podría ser que los pacientes con BN no aprendieron de la retroalimentación sobre WCST pero lo hicieron bien en una tarea de cambio relativamente simple. El estudio actual muestra que las personas con disfunción eréctil no pudieron aprender de la retroalimentación tan eficientemente como los HC. El grupo de AN recuperado mostró puntuaciones intermedias entre AN y HC para la tarea de Brixton, y su desempeño no fue significativamente diferente al de los HC. En el WCST, las personas que se recuperaron demostraron un número significativamente mayor de errores perseverativos en comparación con los HC y mostraron dificultades para desempeñarse estratégicamente en el WCST, lo que sugiere que con tareas más complejas, se desempeñaron mal. Este hallazgo apoya investigaciones previas que proponen el cambio de conjuntos como endofenotipo / biomarcador o rasgo característico de AN [3] - [5].

Con respecto al aprendizaje deficiente de la retroalimentación, los hallazgos son similares a estudios previos que informan un aprendizaje deficiente en una tarea de toma de decisiones [16] - [18] donde ambos grupos de pacientes (AN y BN) no mejoraron y cambiaron de una estrategia desventajosa (elegir riesgos tarjetas versus tarjetas seguras) a una estrategia ventajosa (elegir tarjetas seguras con pequeñas ganancias y pequeñas pérdidas) nuevamente, la retroalimentación (conductual y fisiológica) no facilitó una mejora en el enfoque cognitivo de la tarea de los grupos de DE. Tanto los resultados de WCST como los estudios de toma de decisiones demuestran que las personas con AN y BN tienen dificultades para aprender de experiencias anteriores, lo que se evidencia por una pequeña mejora con el tiempo en estas tareas neurocognitivas. Curiosamente, las personas que se recuperaron de la AN todavía tenían un desempeño menos eficiente que los HC. Esto apoya la evidencia de que los individuos recuperados de AN tienen dificultades para diferenciar la retroalimentación positiva y negativa [19].

Hasta donde sabemos, este estudio ha utilizado el conjunto de datos transversales más grande disponible que informa el desempeño de WCST administrado con la versión electrónica de WCST en personas con TCA. Los puntos fuertes del estudio son el gran tamaño de la muestra, el diseño transversal que incluye los grupos de DE actualmente enfermos y los grupos recuperados, así como un grupo de comparación de CH de la misma edad. Como se destacó anteriormente, el error del experimentador se redujo al mínimo porque todos los estudios incluidos aquí utilizaron la versión computarizada del WCST. Otro punto fuerte del presente estudio es que informa todos los resultados del WCST además de los errores perseverantes. Esto tiene importantes implicaciones clínicas porque la terapia psicológica se centra en el aprendizaje (desaprender conductas desadaptativas y aprender nuevas estrategias) y se basa en gran medida en la retroalimentación. Por lo tanto, comprender el mecanismo por el cual los pacientes utilizan la retroalimentación es informativo.

Este estudio proporciona un mensaje importante sobre la capacidad de cambio cognitivo en AN, BN y grupos recuperados. Esta línea de investigación es potencialmente útil para comprender mejor los TCA en términos de cognición, comorbilidad, diagnóstico de por vida y características de personalidad, y también puede ayudarnos a desarrollar enfoques de tratamiento mejorados. En términos de intervenciones terapéuticas, la Terapia de Remediación Cognitiva (CRT) desarrollada recientemente para AN [20] - [21], permite a los terapeutas abordar la flexibilidad del pensamiento dentro de las sesiones de terapia y ayuda a las personas a desarrollar una conciencia sobre los estilos de pensamiento y a aplicar este conocimiento en sus vida diaria. Los estudios de viabilidad iniciales [21] - [22] muestran resultados positivos, lo que sugiere que un enfoque racional ("ruta cognitiva fría"), que aumenta la conciencia sobre los estilos de pensamiento, podría ser beneficioso para los pacientes con AN. Según una revisión sistemática reciente [23], parece que las personas con AN tienen buenas reservas cognitivas en términos de CI superior al promedio (110). En nuestro conjunto de datos, se replicó cuando analizamos los datos disponibles sobre el coeficiente intelectual. Estas fortalezas se pueden utilizar como recurso cognitivo en terapia. Este estudio destaca que se necesitarán más trabajos y adaptaciones clínicas para ayudar a los pacientes con BN. A partir de informes anteriores, no estaba claro si el cambio de conjunto deficiente constituye parte de la firma neurocognitiva en la BN (debido a estudios a pequeña escala). El presente estudio destaca que pueden ser necesarios más trabajos y adaptaciones clínicas para la BN. Los informes anteriores son menos claros sobre el perfil neurocognitivo en la BN debido a la naturaleza a pequeña escala de los estudios actuales [13].

En un contexto más amplio, el deterioro del rendimiento WCST no es específico para la disfunción eréctil. Las dificultades con la flexibilidad cognitiva se informan en casi todos los trastornos psiquiátricos, sin embargo, estudios de este tipo pueden ayudarnos a pensar en las deficiencias neuropsicológicas relativas. En general, el WCST nos permite acceder a la capacidad de abstracción, pero clínicamente puede informar a los terapeutas de áreas específicas de dificultad, p. Ej. perseveraciones, conceptualización, mantenimiento de conjunto o aprendizaje a través de la tarea a lo largo del tiempo. En comparación con los pacientes con lesión cerebral o esquizofrenia, el rendimiento de las personas con DE es mejor (p. Ej., [24], el metanálisis sobre esquizofrenia informó tamaños del efecto de 1,00 en las categorías WCST completadas y 0,8 en errores perseverativos, que son mayores que el rendimiento de los grupos de ED presentado en este estudio). Un metaanálisis de pacientes con trastorno obsesivo compulsivo [25] informó tamaños de efecto pequeños a medianos en relación con el desempeño de los controles en las categorías WCST completadas (D = 0,23) y errores perseverativos (D = 0,25), que son inferiores a los tamaños del efecto informados en el estudio actual.

Cabe señalar que los datos presentados aquí se combinaron de diferentes estudios disponibles dentro de nuestro departamento. Por lo tanto, la información sobre la medicación, la duración de la enfermedad, el coeficiente intelectual y los subtipos de DE no se incluyeron en el análisis debido a la falta de datos, aunque debe tenerse en cuenta que el 70% de los pacientes tenían el coeficiente intelectual medido con el NART y el coeficiente intelectual previsto era 110 (de = 8,9),. En investigaciones futuras, sería deseable medir estas variables en relación con el rendimiento WCST. Fue difícil reclutar participantes de BN recuperados y el trabajo futuro se beneficiaría de la inclusión de este grupo.

El WCST es la medida neuropsicológica más ampliamente informada de la función ejecutiva y se considera un excelente indicador de la función prefrontal. Existe un interés creciente en las implicaciones de diagnóstico y tratamiento de la flexibilidad cognitiva y el informe de todos los resultados disponibles de esta tarea más ampliamente difundida será útil tanto para los investigadores como para los médicos, que trabajen tanto dentro como fuera del campo de los servicios de urgencias.


Edad y flexibilidad cognitiva

En general, se cree que los adultos de 25 años en adelante muestran el mayor grado de flexibilidad cognitiva. El cerebro humano está completamente desarrollado a mediados de los 20, pero hasta mediados de los 20, los humanos no habían alcanzado su capacidad cognitiva completa. Los niños pequeños muestran un grado significativo de inflexibilidad cognitiva debido a la falta de desarrollo cortical.

Por esta razón, a los niños se les administran diferentes medidas de flexibilidad cognitiva, como la prueba A-no-B (mayores de 1 año), la tarea de clasificación de tarjetas de cambio dimensional (mayores de 5 años), la tarea de clasificación de tarjetas de clasificación múltiple (mayores de 7 años) y la Tarea de clasificación de tarjetas de Wisconsin (de 9 a 11 años). A los adultos generalmente se les administra una prueba demasiado difícil de realizar para los niños llamada & # 8220Stroop Test & # 8221.

La flexibilidad cognitiva de los adolescentes & # 8217 continúa mejorando, y algunas evidencias sugieren que aprenden más rápido de los & # 8220 errores de predicción de recompensa & # 8221 negativos en comparación con los adultos. La capacidad de aprender más rápido de los errores de predicción de recompensas significa que pueden mostrar una mayor flexibilidad cognitiva en ciertas capacidades en comparación con los adultos.

Después del desarrollo máximo del cerebro a mediados de los 20, se cree que la flexibilidad cognitiva se puede mantener y / o mejorar durante un largo período de tiempo. Hay una transición entre la mediana edad y la edad adulta en la que la cognición disminuye y se establece la neurodegeneración. Los ancianos tienden a tener una flexibilidad cognitiva significativamente reducida en comparación con los adultos más jóvenes.


Método

Los participantes fueron 73 voluntarios sanos, 42 hombres y 31 mujeres, con una edad media de 31,3 años (DE = 10,2). Había 49 caucásicos, 14 negros, cinco hispanos, tres asiáticos y dos de etnia mixta. Todos proporcionaron su consentimiento informado por escrito. Todos los sujetos estaban libres de trastornos psiquiátricos, según lo determinado por una entrevista de diagnóstico estructurada, y en buena salud física, según lo determinado por el examen físico, el electrocardiograma y las pruebas de laboratorio, incluidas las pruebas de función hepática y tiroidea y análisis de orina. Todos habían estado libres de abuso de drogas y alcohol durante al menos 6 meses.

Los sujetos fueron evaluados con la prueba de clasificación de tarjetas de Wisconsin, una medida ampliamente utilizada de la función cognitiva prefrontal que es sensible a la capacidad de un sujeto para generar hipótesis, establecer conjuntos de respuestas y cambiar conjuntos con fluidez. Se requiere que los sujetos clasifiquen las tarjetas de estímulo sobre la base de los atributos de percepción (color, forma, número). El único comentario proporcionado por el administrador es si cada respuesta es correcta o incorrecta. La regla de clasificación se cambia después de 10 respuestas correctas consecutivas. La prueba se interrumpe cuando el sujeto ha aprendido dos iteraciones de las tres reglas de clasificación o ha alcanzado los 128 intentos (7). La medida de resultado primaria utilizada para este estudio fue el número de errores perseverativos, una medida sensible a la capacidad de un individuo para cambiar con fluidez conjuntos cognitivos y la medida utilizada por Egan y sus colegas (6).

COMT Val158Met los genotipos se determinaron mediante polimorfismo de longitud de fragmentos de restricción. Se generó un producto de reacción en cadena de la polimerasa (PCR) de 109 pares de bases en 30 ciclos con una temperatura de hibridación de 54 ° C usando los cebadores Comt1 nt 1881 5 'CTCATCACCATCGAGATCAA y Comt2 nt 1989 5' CCAGGTCTGACAACGGGTCA.

los val y reunió Los alelos se discriminaron digiriendo el producto de PCR con N1aIII a 37 ° C durante 4 horas, seguido de electroforesis en gel de agarosa al 4,5%. los val / val homocigotos (86 y 23 pares de bases), conocido / conocido homocigotos (68 y 18 pares de bases), y val / met Los heterocigotos (86, 68, 23 y 18 pares de bases) se visualizaron mediante tinción con bromuro de etidio.

El análisis de varianza de Welch (ANOVA) se llevó a cabo con el genotipo COMT como factor independiente y el número de errores perseverativos como medida dependiente (8). Este procedimiento se utilizó porque una prueba del supuesto de homogeneidad de la varianza indicó que las varianzas dentro de los grupos eran diferentes (F = 3.42, gl = 2, 70, p = 0.04), y el ANOVA de Welch es robusto para tales violaciones. A continuación, se utilizó un análisis de modelo mixto que se ajusta a varianzas separadas para cada grupo para realizar comparaciones por pares.


Beneficios de la evaluación [editar | editar fuente]

El factor más beneficioso de la evaluación neuropsicológica es que proporciona un diagnóstico preciso del trastorno para el paciente cuando el psicólogo no tiene claro qué padece exactamente. Esto permite un tratamiento preciso más adelante en el proceso porque el tratamiento está impulsado por los síntomas exactos del trastorno y cómo un paciente específico puede reaccionar a diferentes tratamientos. El Dr. Burke es un psicólogo del Centro de Terapia Cerebral en Westlake, California, que utiliza evaluaciones neuropsicológicas para diagnosticar a sus pacientes. Por lo general, sus pacientes sentían que querían saber qué les pasaba, incluso si el pronóstico no era bueno. La evaluación permite al psicólogo y al paciente comprender la gravedad del déficit y permitir una mejor toma de decisiones por ambas partes. También es útil para comprender el deterioro de las enfermedades porque se puede evaluar al paciente varias veces para ver cómo está progresando el trastorno.

Un área donde las evaluaciones neuropsicológicas pueden ser beneficiosas son los casos forenses en los que se cuestiona la competencia del criminal debido a una posible lesión o daño cerebral. Una evaluación neuropsicológica puede mostrar daño cerebral cuando la neuroimagen ha fallado. También puede determinar si el individuo está fingiendo un trastorno (fingiendo) para obtener una sentencia menor. & # 915 & # 93

Las evaluaciones neuropsicológicas generalmente no toman mucho tiempo, y la mayoría de las pruebas se completan en 6 a 12 horas o menos. Esta vez, sin embargo, no incluye el papel del psicólogo que interpreta los datos, califica la prueba, hace formulaciones y redacta un informe formal. & # 915 & # 93


Contribución a la ciencia [editar | editar fuente]

El estudio de Molaison revolucionó la comprensión de la organización de la memoria humana. Ha proporcionado una amplia evidencia del rechazo de las viejas teorías y la formación de nuevas teorías sobre la memoria humana, en particular sobre sus procesos y las estructuras neuronales subyacentes (cf. Kolb & amp Whishaw, 1996). A continuación, se describen algunas de las principales ideas.

El cerebro de Molaison es objeto de un estudio anatómico sin precedentes financiado por la Fundación Dana y la Fundación Nacional de Ciencias. El proyecto, encabezado por Jacopo Annese, director del Observatorio del Cerebro en UC San Diego, proporcionará un estudio microscópico completo de todo el cerebro y revelará la base neurológica del deterioro de la memoria histórica de Molaison en la resolución celular. El 4 de diciembre de 2009, el grupo de Annese adquirió 2401 cortes de cerebro con solo dos cortes dañados y 16 cortes potencialmente problemáticos. Actualmente, el grupo está planificando la segunda fase del proyecto. & # 914 & # 93 & # 9110 & # 93

Amnesia [editar | editar fuente]

El estado general de Molaison se ha descrito como amnesia anterógrada intensa, así como amnesia retrógrada graduada temporalmente (Smith & amp Kosslyn, 2007). HM fue incapaz de formar nuevos recuerdos a largo plazo de nuevos eventos o nuevos conocimientos semánticos; básicamente vivió en el presente (Corkin, 2002). Dado que HM no mostró ningún deterioro de la memoria antes de la cirugía, la extirpación de los lóbulos temporales mediales puede ser responsable de su trastorno de la memoria. En consecuencia, se puede suponer que los lóbulos temporales mediales son un componente principal involucrado en la formación de recuerdos semánticos y episódicos a largo plazo (cf. lóbulos temporales mediales descritos como una zona de convergencia para la codificación episódica en Smith & amp Kosslyn, 2007). Se han obtenido más pruebas de esta suposición mediante estudios de otros pacientes con lesiones de las estructuras del lóbulo temporal medial. & # 917 & # 93

A pesar de sus síntomas amnésicos, Molaison se desempeñó con bastante normalidad en las pruebas de capacidad intelectual, lo que indica que algunas funciones de la memoria (por ejemplo, reservas a corto plazo, reservas de palabras, fonemas, etc.) no se vieron afectadas por la cirugía (Smith & amp Kosslyn, 2007 Corkin , 2002). Sin embargo, para la comprensión y producción del lenguaje a nivel de oraciones, Molaison exhibió las mismas deficiencias y conservación que en la memoria (MacKay, James, Taylor & amp Marian, 2007). Molaison pudo recordar información en breves intervalos de tiempo. Esto fue probado en un experimento de memoria de trabajo que involucró el recuerdo de números presentados previamente, de hecho, su desempeño no fue peor que el de los sujetos de control (Smith & amp Kosslyn, 2007). Este hallazgo proporciona evidencia de que la memoria de trabajo no se basa en estructuras temporales mediales. Además, respalda la distinción general entre las reservas de memoria a corto y largo plazo (Kolb & amp Whishaw, 1996). La recuperación de palabras en gran parte intacta de Molaison proporciona evidencia de que la memoria léxica es independiente de las estructuras temporales mediales (Corkin, 2002).

Aprendizaje de habilidades motoras [editar | editar fuente]

Además de su memoria de trabajo intacta y sus habilidades intelectuales, los estudios de la capacidad de Molaison para adquirir nuevas habilidades motoras demostraron un aprendizaje motor preservado (Corkin, 2002). En un estudio realizado por Milner a principios de la década de 1960, Molaison adquirió la nueva habilidad de dibujar una figura mirando su reflejo en un espejo (Corkin, 2002). Un estudio realizado por Corkin (1968) proporcionó más pruebas del aprendizaje motor intacto. En este estudio, Molaison fue evaluado en tres tareas de aprendizaje motor y demostró habilidades de aprendizaje motor completas en todas ellas. Su capacidad para aprender ciertos procedimientos de resolución de problemas también se ha demostrado con la tarea de la Torre de Hanoi (Kolb & amp Whishaw, 1996).

Los experimentos que implican la preparación de la repetición subrayaron la capacidad de Molaison para adquirir recuerdos implícitos (no conscientes), en contraste con su incapacidad para adquirir nuevos recuerdos semánticos y episódicos explícitos (Corkin, 2002). Estos hallazgos proporcionan evidencia de que la memoria de habilidades y la preparación de la repetición se basan en estructuras neuronales diferentes que las memorias de episodios y hechos, mientras que la memoria de procedimiento y la preparación de la repetición no se basan en las estructuras temporales mediales eliminadas de Molaison, la memoria semántica y episódica sí (cf. Corkin, 1984).

La disociación de las habilidades de aprendizaje implícitas y explícitas de Molaison a lo largo de sus estructuras neuronales subyacentes ha servido como una contribución importante a nuestra comprensión de la memoria humana: las memorias a largo plazo no son unitarias y pueden diferenciarse como declarativas o no declarativas (Smith & amp Kosslyn , 2007).

Memoria espacial [editar | editar fuente]

Según Corkin (2002), los estudios de las habilidades de memoria de Molaison también han proporcionado información sobre las estructuras neuronales responsables de la memoria espacial y el procesamiento de la información espacial. A pesar de su incapacidad general para formar nuevos recuerdos episódicos o fácticos a largo plazo, así como su gran deficiencia en ciertas pruebas de memoria espacial, Molaison pudo dibujar un mapa bastante detallado del diseño topográfico de su residencia. Este hallazgo es notable ya que Molaison se había mudado a la casa cinco años después de su cirugía y, por lo tanto, dada su amnesia anterógrada severa y los conocimientos de otros casos, la expectativa común era que la adquisición de recuerdos topográficos también se hubiera visto afectada. Corkin (2002) planteó la hipótesis de que Molaison “fue capaz de construir un mapa cognitivo de la distribución espacial de su casa como resultado de la locomoción diaria de una habitación a otra” (p. & # 160156).

Con respecto a las estructuras neuronales subyacentes, Corkin (2002) sostiene que la capacidad de Molaison para adquirir el plano del piso se debe a estructuras parcialmente intactas de su red de procesamiento espacial (por ejemplo, la parte posterior de su giro parahipocampal). Además de su memoria topográfica, Molaison mostró cierto aprendizaje en una tarea de memorización-reconocimiento de imágenes, así como en una prueba de reconocimiento de rostros famosos, pero en esta última solo cuando se le proporcionó una pista fonémica. El desempeño positivo de Molaison en la tarea de reconocimiento de imágenes podría deberse a partes libres de su corteza perirrinal ventral.

Además, Corkin (2002) argumenta que a pesar de la incapacidad general de Molaison para formar nuevos recuerdos declarativos, parecía ser capaz de adquirir información pequeña y empobrecida sobre la vida pública (por ejemplo, recuperación de nombres de celebridades). Estos hallazgos subrayan la importancia de los sitios extrahipocampales salvados de Molaison en la memoria semántica y de reconocimiento y mejoran nuestra comprensión de las interrelaciones entre las diferentes estructuras del lóbulo temporal medial. El gran deterioro de Molaison en ciertas tareas espaciales proporciona más evidencia de la asociación del hipocampo con la memoria espacial (Kolb & amp Whishaw, 1996).

Consolidación de la memoria [editar | editar fuente]

Otra contribución de Molaison a la comprensión de la memoria humana se refiere a las estructuras neuronales del proceso de consolidación de la memoria, que es responsable de formar memorias estables a largo plazo (Eysenck & amp Keane, 2005). Molaison mostró una amnesia retrógrada graduada temporalmente en la forma en que "aún podía recordar recuerdos de la infancia, pero tenía dificultades para recordar eventos que sucedieron durante los años inmediatamente anteriores a la cirugía" (Smith & amp Kosslyn, 2007, p. & # 160214). Sus viejos recuerdos no se vieron afectados, mientras que los relativamente cercanos a la cirugía sí. Esta es una prueba de que los recuerdos de la infancia anterior no se basan en el lóbulo temporal medial, mientras que los recuerdos más recientes a largo plazo parecen hacerlo (Smith & amp Kosslyn, 2007). Se hipotetiza que las estructuras temporales medial, que fueron removidas en la cirugía, están involucradas en la consolidación de recuerdos en la forma en que “se cree que las interacciones entre el lóbulo temporal medial y varias regiones corticales laterales almacenan recuerdos fuera de los lóbulos temporales medial lentamente formando vínculos directos entre las representaciones corticales de la experiencia ”(Smith & amp Kosslyn, 2007, p. & # 160214).


Expresiones de gratitud

Los autores desean agradecer a Sura Muscati, Christopher Degagne, Philippe Chouinard, Jake Burack y Natalie Russo por sus comentarios sobre el manuscrito, y a todos los investigadores que facilitaron este metanálisis rastreando a colegas y compartiendo datos sin procesar.

Contribuciones de autor

OL concibe el estudio, participó en su diseño y coordinación, realizó medición y análisis estadístico, interpretación de los datos y redactó el manuscrito SA participó en el diseño y coordinación del estudio, realizó medición y análisis estadístico, y ayudó a redactar el manuscrito. Ambos autores leyeron y aprobaron el manuscrito final.


Artículo de Investigación Original

  • 1 Modelado cognitivo en sistemas dinámicos humano-máquina, Departamento de Psicología y Ergonomía, Universidad Técnica de Berlín, Berlín, Alemania
  • 2 Laboratorio especial de imágenes cerebrales no invasivas, Instituto Leibniz de Neurobiología, Magdeburgo, Alemania

La toma de decisiones es un proceso cognitivo de alto nivel basado en procesos cognitivos como la percepción, la atención y la memoria. Las situaciones de la vida real requieren que se tomen una serie de decisiones, y cada decisión depende de la retroalimentación previa de un entorno potencialmente cambiante. Para obtener una mejor comprensión de los procesos subyacentes de la toma de decisiones dinámica, aplicamos el método de modelado cognitivo en una tarea compleja de aprendizaje de categorías basada en reglas. Aquí, los participantes primero necesitaban identificar la conjunción de dos reglas que definían una categoría objetivo y luego adaptarse a una reversión de las contingencias de retroalimentación. Desarrollamos un modelo ACT-R para los aspectos centrales de esta tarea dinámica de toma de decisiones. Un objetivo importante de nuestro modelo fue que proporciona una descripción general de cómo se resuelven tales tareas y, con cambios menores, es aplicable a otros materiales de estímulo. El modelo se implementó como una mezcla de un enfoque basado en ejemplos y uno basado en reglas que incorpora aspectos perceptivo-motores y metacognitivos también. The model solves the categorization task by first trying out one-feature strategies and then, as a result of repeated negative feedback, switching to two-feature strategies. Overall, this model solves the task in a similar way as participants do, including generally successful initial learning as well as reversal learning after the change of feedback contingencies. Moreover, the fact that not all participants were successful in the two learning phases is also reflected in the modeling data. However, we found a larger variance and a lower overall performance of the modeling data as compared to the human data which may relate to perceptual preferences or additional knowledge and rules applied by the participants. In a next step, these aspects could be implemented in the model for a better overall fit. In view of the large interindividual differences in decision performance between participants, additional information about the underlying cognitive processes from behavioral, psychobiological and neurophysiological data may help to optimize future applications of this model such that it can be transferred to other domains of comparable dynamic decision tasks.


Card Sorting: A Definitive Guide

Card sorting is a technique that many information architects (and related professionals.) use as an input to the structure of a site or product. With so many of us using the technique, why would we need to write an article on it?

While card sorting is described in a few texts and a number of sites, most descriptions are brief. There is not a definitive article that describes the technique and its variants and explains the issues to watch out for. Given the number of questions posted to discussion groups, and discussions we have had at conferences, we thought it was time to get all of the issues in one place.

This article provides a detailed description of the basic technique, with some focus on using the technique for more complex sites. This article does not cover some issues such as the use of online tools, which will be covered in a future article.

Card sorting is a quick, inexpensive, and reliable method, which serves as input into your information design process. Card sorting generates an overall structure for your information, as well as suggestions for navigation, menus, and possible taxonomies.

While card sorting might not provide you with final structure, it can help you answer many questions you will need to tackle throughout the information design phase. For example, more than likely there will be some areas that users disagree on regarding groupings or labels. In these cases, card sorting can help identify trends, such as:

  • Do the users want to see the information grouped by subject, process, business group, or information type?
  • How similar are the needs of the different user groups? & gt
  • How different are their needs?
  • How many potential main categories are there? (typically relates to navigation)
  • What should those groups be called?

Card sorting can help answer these types of questions, making you better equipped to tackle the information design phase.


Learning representations in a gated prefrontal cortex model of dynamic task switching

Tel.: +1-303-492-0054 fax: +1-303-492-2967. E-mail addresses: [email protected] .

Department of Psychology, University of Colorado Boulder, 345 UCB, Boulder, CO 80309-0345, USA

Tel.: +1-303-492-0054 fax: +1-303-492-2967. E-mail addresses: [email protected] .

Department of Psychology, University of Colorado Boulder, 345 UCB, Boulder, CO 80309-0345, USA

Tel.: +1-303-492-0054 fax: +1-303-492-2967. E-mail addresses: [email protected] .

Department of Psychology, University of Colorado Boulder, 345 UCB, Boulder, CO 80309-0345, USA

Tel.: +1-303-492-0054 fax: +1-303-492-2967. E-mail addresses: [email protected] .

Abstracto

The prefrontal cortex is widely believed to play an important role in facilitating people's ability to switch performance between different tasks. We present a biologically-based computational model of prefrontal cortex (PFC) that explains its role in task switching in terms of the greater flexibility conferred by activation-based working memory representations in PFC, as compared with more slowly adapting weight-based memory mechanisms. Specifically we show that PFC representations can be rapidly updated when a task switches via a dynamic gating mechanism based on a temporal-differences reward-prediction learning mechanism. Unlike prior models of this type, the present model develops all of its internal representations via learning mechanisms as shaped by the demands of continuous periodic task switching. This advance opens up a new domain of research into the interactions between working memory task demands and the representations that develop to meet them. Results on a version of the Wisconsin card sorting task are presented for the full model and a number of comparison networks that test the importance of various model features. Furthermore, we show that a lesioned model produces perseverative errors like those seen in frontal patients.


Contribution to science [ edit | editar fuente]

The study of Molaison revolutionized the understanding of the organization of human memory. It has provided broad evidence for the rejection of old theories and the formation of new theories on human memory, in particular about its processes and the underlying neural structures (cf. Kolb & Whishaw, 1996). In the following, some of the major insights are outlined.

Molaison's brain is the subject of an unprecedented anatomical study funded by the Dana Foundation and the National Science Foundation. The project, headed by Jacopo Annese, the Director of The Brain Observatory at UC San Diego, will provide a complete microscopic survey of the entire brain and reveal the neurological basis of Molaison's historical memory impairment at cellular resolution. On December 4, 2009, Annese's group acquired 2401 brain slices with only two damaged slices and 16 potentially problematic slices. The group is currently planning the second phase of the project. Β] ⎖]

Amnesia [ edit | editar fuente]

Molaison's general condition has been described as heavy anterograde amnesia, as well as temporally graded retrograde amnesia (Smith & Kosslyn, 2007). HM was unable to form new long-term memories of new events or new semantic knowledge – he basically lived in the present (Corkin, 2002). Since HM did not show any memory impairment before the surgery, the removal of the medial temporal lobes can be held responsible for his memory disorder. Consequently, the medial temporal lobes can be assumed to be a major component involved in the formation of semantic and episodic long-term memories (cf. medial temporal lobes described as a convergence zone for episodic encoding in Smith & Kosslyn, 2007). Further evidence for this assumption has been gained by studies of other patients with lesions of their medial temporal lobe structures. Ε]

Despite his amnesic symptoms, Molaison performed quite normally in tests of intellectual ability, indicating that some memory functions (e.g., short-term stores, stores for words, phonemes, etc.) were not impaired by the surgery (Smith & Kosslyn, 2007 Corkin, 2002). However, for sentence-level language comprehension and production, Molaison exhibited the same deficits and sparing as in memory (MacKay, James, Taylor & Marian, 2007). Molaison was able to remember information over short intervals of time. This was tested in a working memory experiment involving the recall of previously presented numbers in fact, his performance was no worse than that of control subjects (Smith & Kosslyn, 2007). This finding provides evidence that working memory does not rely on medial temporal structures. It further supports the general distinction between short-term and long-term stores of memory (Kolb & Whishaw, 1996). Molaison's largely intact word retrieval provides evidence that lexical memory is independent of the medial temporal structures (Corkin, 2002).

Motor skill learning [ edit | editar fuente]

In addition to his intact working memory and intellectual abilities, studies of Molaison's ability to acquire new motor skills demonstrated preserved motor learning (Corkin, 2002). In a study conducted by Milner in the early 1960s, Molaison acquired the new skill of drawing a figure by looking at its reflection in a mirror (Corkin, 2002). Further evidence for intact motor learning was provided in a study carried out by Corkin (1968). In this study, Molaison was tested on three motor learning tasks and demonstrated full motor learning abilities in all of them. His ability to learn certain problem-solving procedures has also been shown with the Tower of Hanoi task (Kolb & Whishaw, 1996).

Experiments involving repetition priming underscored Molaison's ability to acquire implicit (non-conscious) memories, in contrast to his inability to acquire new explicit semantic and episodic memories (Corkin, 2002). These findings provide evidence that memory of skills and repetition priming rely on different neural structures than memories of episodes and facts whereas procedural memory and repetition priming do not rely on the medial temporal structures removed from Molaison, semantic and episodic memory do (cf. Corkin, 1984).

The dissociation of Molaison's implicit and explicit learning abilities along their underlying neural structures has served as an important contribution to our understanding of human memory: Long-term memories are not unitary and can be differentiated as being either declarative or non-declarative (Smith & Kosslyn, 2007).

Spatial memory [ edit | editar fuente]

According to Corkin (2002), studies of Molaison's memory abilities have also provided insights regarding the neural structures responsible for spatial memory and processing of spatial information. Despite his general inability to form new episodic or factual long-term memories, as well as his heavy impairment on certain spatial memory tests, Molaison was able to draw a quite detailed map of the topographical layout of his residence. This finding is remarkable since Molaison had moved to the house five years after his surgery and hence, given his severe anterograde amnesia and insights from other cases, the common expectation was that the acquisition of topographical memories would have been impaired as well. Corkin (2002) hypothesized that Molaison “was able to construct a cognitive map of the spatial layout of his house as the result of daily locomotion from room to room” (p.𧆜).

Regarding the underlying neural structures, Corkin (2002) argues that Molaison's ability to acquire the floor plan is due to partly intact structures of his spatial processing network (e.g., the posterior part of his parahippocampal gyrus). In addition to his topographical memory, Molaison showed some learning in a picture memorization-recognition task, as well as in a famous faces recognition test, but in the latter only when he was provided with a phonemic cue. Molaison's positive performance in the picture recognition task might be due to spared parts of his ventral perirhinal cortex.

Furthermore, Corkin (2002) argues that despite Molaison's general inability to form new declarative memories, he seemed to be able to acquire small and impoverished pieces of information regarding public life (e.g., cued retrieval of celebrities' names). These findings underscore the importance of Molaison's spared extrahippocampal sites in semantic and recognition memory and enhance our understanding of the interrelations between the different medial temporal lobe structures. Molaison's heavy impairment in certain spatial tasks provides further evidence for the association of the hippocampus with spatial memory (Kolb & Whishaw, 1996).

Memory consolidation [ edit | editar fuente]

Another contribution of Molaison to understanding of human memory regards the neural structures of the memory consolidation process, which is responsible for forming stable long-term memories (Eysenck & Keane, 2005). Molaison displayed a temporally graded retrograde amnesia in the way that he “could still recall childhood memories, but he had difficulty remembering events that happened during the years immediately preceding the surgery” (Smith & Kosslyn, 2007, p.𧇖). His old memories were not impaired, whereas the ones relatively close to the surgery were. This is evidence that the older childhood memories do not rely on the medial temporal lobe, whereas the more recent long-term memories seem to do so (Smith & Kosslyn, 2007). The medial temporal structures, which were removed in the surgery, are hypothesized to be involved in the consolidation of memories in the way that “interactions between the medial temporal lobe and various lateral cortical regions are thought to store memories outside the medial temporal lobes by slowly forming direct links between the cortical representations of the experience” (Smith & Kosslyn, 2007, p.𧇖).


Expresiones de gratitud

The authors would like to thank Sura Muscati, Christopher Degagne, Philippe Chouinard, Jake Burack, and Natalie Russo for comments on the manuscript, and all the researchers who facilitated this meta-analysis by tracking down colleagues and sharing raw data.

Author Contributions

OL conceived of the study, participated in its design and coordination, performed measurement and statistical analysis, interpretation of the data, and drafted the manuscript SA participated in the design and coordination of the study, performed measurement and statistical analysis, and helped to draft the manuscript. Both authors read and approved the final manuscript.


Artículo de Investigación Original

  • 1 Cognitive Modeling in Dynamic Human-Machine Systems, Department of Psychology and Ergonomics, Technical University Berlin, Berlin, Germany
  • 2 Special Lab Non-Invasive Brain Imaging, Leibniz Institute for Neurobiology, Magdeburg, Germany

Decision-making is a high-level cognitive process based on cognitive processes like perception, attention, and memory. Real-life situations require series of decisions to be made, with each decision depending on previous feedback from a potentially changing environment. To gain a better understanding of the underlying processes of dynamic decision-making, we applied the method of cognitive modeling on a complex rule-based category learning task. Here, participants first needed to identify the conjunction of two rules that defined a target category and later adapt to a reversal of feedback contingencies. We developed an ACT-R model for the core aspects of this dynamic decision-making task. An important aim of our model was that it provides a general account of how such tasks are solved and, with minor changes, is applicable to other stimulus materials. The model was implemented as a mixture of an exemplar-based and a rule-based approach which incorporates perceptual-motor and metacognitive aspects as well. The model solves the categorization task by first trying out one-feature strategies and then, as a result of repeated negative feedback, switching to two-feature strategies. Overall, this model solves the task in a similar way as participants do, including generally successful initial learning as well as reversal learning after the change of feedback contingencies. Moreover, the fact that not all participants were successful in the two learning phases is also reflected in the modeling data. However, we found a larger variance and a lower overall performance of the modeling data as compared to the human data which may relate to perceptual preferences or additional knowledge and rules applied by the participants. In a next step, these aspects could be implemented in the model for a better overall fit. In view of the large interindividual differences in decision performance between participants, additional information about the underlying cognitive processes from behavioral, psychobiological and neurophysiological data may help to optimize future applications of this model such that it can be transferred to other domains of comparable dynamic decision tasks.


Card Sorting: A Definitive Guide

Card sorting is a technique that many information architects (and related professionals.) use as an input to the structure of a site or product. With so many of us using the technique, why would we need to write an article on it?

While card sorting is described in a few texts and a number of sites, most descriptions are brief. There is not a definitive article that describes the technique and its variants and explains the issues to watch out for. Given the number of questions posted to discussion groups, and discussions we have had at conferences, we thought it was time to get all of the issues in one place.

This article provides a detailed description of the basic technique, with some focus on using the technique for more complex sites. This article does not cover some issues such as the use of online tools, which will be covered in a future article.

Card sorting is a quick, inexpensive, and reliable method, which serves as input into your information design process. Card sorting generates an overall structure for your information, as well as suggestions for navigation, menus, and possible taxonomies.

While card sorting might not provide you with final structure, it can help you answer many questions you will need to tackle throughout the information design phase. For example, more than likely there will be some areas that users disagree on regarding groupings or labels. In these cases, card sorting can help identify trends, such as:

  • Do the users want to see the information grouped by subject, process, business group, or information type?
  • How similar are the needs of the different user groups? & gt
  • How different are their needs?
  • How many potential main categories are there? (typically relates to navigation)
  • What should those groups be called?

Card sorting can help answer these types of questions, making you better equipped to tackle the information design phase.


Método

The participants were 73 healthy volunteers, 42 men and 31 women, with a mean age of 31.3 years (SD=10.2). There were 49 Caucasians, 14 blacks, five Hispanics, three Asians, and two with mixed ethnicity. All provided written informed consent. All subjects were free of psychiatric disorders, as determined by a structured diagnostic interview, and in good physical health, as determined by physical examination, electrocardiogram, and laboratory tests including liver and thyroid function tests and urinalysis. All had been free of drug and alcohol abuse for at least 6 months.

The subjects were each assessed with the Wisconsin Card Sorting Test, a widely used measure of prefrontal cognitive function that is sensitive to a subject’s ability to generate hypotheses, establish response sets, and fluently shift sets. Subjects are required to sort stimulus cards on the basis of perceptual attributes (color, form, number). The only feedback provided by the administrator is whether each response is correct or incorrect. The sorting rule is changed after 10 consecutive correct responses. Testing is discontinued when the subject has learned two iterations of the three sorting rules or has reached 128 trials (7). The primary outcome measure used for this study was the number of perseverative errors, a measure sensitive to an individual’s ability to fluently shift cognitive sets and the measure used by Egan and colleagues (6).

COMT Val158Met genotypes were determined by restriction fragment length polymorphism. A 109-base-pair polymerase chain reaction (PCR) product was generated in 30 cycles with an annealing temperature of 54°C by using the primers Comt1 nt 1881 5′ CTCATCACCATCGAGATCAA and Comt2 nt 1989 5′ CCAGGTCTGACAACGGGTCA.

los val y met alleles were discriminated by digesting the PCR product with N1aIII at 37°C for 4 hours, followed by 4.5% agarose gel electrophoresis. los val/val homozygotes (86 and 23 base pairs), met/met homozygotes (68 and 18 base pairs), and val/met heterozygotes (86, 68, 23, and 18 base pairs) were visualized by ethidium bromide staining.

Welch’s analysis of variance (ANOVA) was carried out with COMT genotype as the independent factor and number of perseverative errors as the dependent measure (8). This procedure was used because a test of the assumption of homogeneity of variance indicated that the variances within the groups were dissimilar (F=3.42, df=2, 70, p=0.04), and Welch’s ANOVA is robust to such violations. A mixed-model analysis that fit separate variances for each group was then used to conduct paired comparisons.


Discusión

This study explored WCST performance as a measure of cognitive flexibility, reporting various outcomes in a large dataset of actively ill, recovered and healthy controls collated from several studies conducted within our department. Patients with AN and BN performed poorly in almost all domains of WCST. Results showed that in terms of flexibility (perseverative errors), there was no significant difference between inpatient and outpatients with anorexia, but rather inpatients made significantly more nonperseverative errors, a finding which can reflect problems with attention and poor nutritional status. People with a past history of AN showed better performance than actively ill participants however perseverative errors, conceptual level responses, and number of categories completed (the main flexibility outcomes) were significantly impaired compared to HC participants. The effect sizes, however, were smaller between HC and people with a past history of AN suggesting that flexibility can be improved relative to active illness state.

In general, our results clearly replicate studies which report poor cognitive flexibility in AN [4], [13], [14]. This study extends knowledge about set-shifting in BN, showing that patients with BN perform as poorly on the WCST as those with AN. People in a stage of good recovery from AN still had problems with perseverations and conceptual strategy use in this task. A recent report on a similar large dataset using a different measure of set-shifting – the Brixton Special anticipation task [15] - found that patients with AN performed significantly worse than HC and BN participant groups. In contrast, in the current study, we found that both actively ill ED patient groups (AN and BN) had worse performance in comparison to HCs and in some aspects of the tasks (e.g. perseverative responses and conceptual level of responses), people who had recovered also showed poor performance. One possible explanation for this finding could be that although both the Brixton task and WCST measure flexibility, they differ in terms of their complexity. In the Brixton task, participants are told explicitly that the sorting principle will change and are therefore alert to future rule changes. In the WCST, participants must identify the rule in order to respond correctly, with this rule subject to modification. Thus, the WCST may involve increased levels of ambiguity, as unlike the Brixton task, participants are not explicitly told that the rules will change throughout the task. The WCST is dependent on cognitive operations such as searching for a new category and consolidating the correct classification category. The tasks also differ in how feedback is provided. Whereas the WCST provides feedback in which participants are told they are “right” or “wrong,” for the Brixton task, the designated correct answer is provided by definition when the next array is shown. This type of feedback is arguably less pronounced and requires the additional process of remembering the immediately previous response and matching for correctness. In summary, the instructions are more explicit in the Brixton task and feedback is arguably more pronounced in the WCST.

Therefore an explanation for this finding could be that patients with BN failed to learn from the feedback on WCST but did well in a relatively simple switching task. The current study shows that people with ED were not able to learn from the feedback as efficiently as HCs. The recovered AN group showed intermediate scores between AN and HC for the Brixton task, and their performance was not significantly different from HCs. In the WCST, people who were recovered demonstrated a significantly higher number of perseverative errors compared to HC and showed difficulties in performing strategically on the WCST, suggesting that with more complex tasks, they performed poorly. This finding supports previous research proposing set-shifting as an endophenotype/biomarker or trait characteristic for AN [3]–[5].

Regarding poor learning from feedback, the findings are similar to previous studies which report poor learning in a decision making task [16]–[18] where both patient groups (AN and BN) failed to improve and shift from a disadvantageous strategy (picking risky cards versus safe cards) to an advantageous strategy (picking safe cards with small wins and small amount of losses) again feedback (behavioural and physiological) did not facilitate an improvement in the ED groups' cognitive approach to the task. Both WCST results and decision making studies demonstrate that people with AN and BN have difficulty learning from previous experiences, evidenced by little improvement over time in these neurocognitive tasks. Interestingly, people recovered from AN still were performing less efficiently than HCs. This supports the evidence that individuals recovered from AN have difficulties in differentiating positive and negative feedback [19].

To our knowledge, this study has used the largest available cross-sectional dataset reporting WCST performance administered with the electronic version of the WCST in people with EDs. The strengths of the study are the large sample size, cross-sectional design including currently ill ED groups and recovered groups, as well as an age matched HC comparison group. As highlighted before, experimenter error was reduced to minimum because all studies included here used the computerised version of the WCST. A further strength of the present study is that it reports all outcomes of the WCST in addition to perseverative errors. This has important clinical implications because psychological therapy is focused on learning (unlearning maladaptive behaviours and learning new strategies) and is largely based on feedback. Therefore, understanding the mechanism by which feedback is used by patients is informative.

This study provides an important message about cognitive shifting ability in AN, BN and recovered groups. This line of research is potentially useful to better understand EDs in terms of cognition as well as comorbidity, lifetime diagnosis and personality characteristics and may also help us develop improved treatment approaches. In terms of therapeutic interventions, the recently developed Cognitive Remediation Therapy (CRT) for AN [20]–[21], allows therapists to address flexibility of thinking within therapy sessions and helps individuals develop an awareness about thinking styles and apply this knowledge in their daily lives. Initial feasibility studies [21]–[22] show positive results, suggesting that a rational approach (“cold cognitive route”), raising awareness of thinking styles, might be beneficial for patients with AN. From a recent systematic review [23], it seems that people with AN have good cognitive reserves in terms of higher than average IQ (110). In our dataset it was replicated when we analysed available data on IQ. These strengths can be used as a cognitive resource in therapy. This study highlights that further work and clinical adaptations to support BN patients will be needed. From previous reports, it was not clear whether poor set shifting constitutes part of the neurocognitive signature in BN (because of small scale studies). The present study highlights that more work and clinical adaptations for BN may be needed. Previous reports are less clear about the neurocognitive profile in BN due to the small scale nature of current studies [13].

In the broader context, WCST performance impairment is not specific for ED. Difficulties with cognitive flexibility are reported in almost every psychiatric disorder however studies of this kind can help us to think about the relative neuropsychological impairments. In general, the WCST allows us to access abstraction ability but clinically it can inform therapists of specific areas of difficulty, e.g. perseverations, conceptualisation, maintaining set or learning through the task over the time. In comparison to brain lesion or schizophrenia patients, performance of people with ED is better (e.g. [24], meta-analysis on schizophrenia reported effect sizes of 1.00 on WCST categories completed and 0.8 on perseverative errors, which are greater than the ED groups performance presented in this study). A meta-analysis of obsessive compulsive disorder patients [25] reported small to medium effect sizes relative to controls performance on WCST categories completed (D = 0.23) and perseverative errors (D = 0.25), which are lower than the effect sizes reported in the current study.

It is of note that data presented here were merged from different studies available within our department. Therefore, information about medication, illness duration, IQ and subtypes of the ED were not included in the analysis due to missing data, although it should be noted that 70% of patients had IQ measured using the NART and the predicted IQ was 110 (s.d. = 8.9), . In future research, it would be desirable to measure these variables in relation to WCST performance. It was difficult to recruit recovered BN participants and future work would benefit from including this group.

The WCST is the most widely reported neuropsychological measure of executive function and is viewed as an excellent indicator of prefrontal function. There is a growing interest in the diagnostic and treatment implications of cognitive flexibility and reporting all the available outcomes of this most widely disseminated task will be useful to researchers and clinicians alike, working both inside and outside of the ED field.


Age and Cognitive Flexibility

Generally adults ages 25 and up are thought to display the greatest degree of cognitive flexibility. The human brain is fully developed by the mid-20s, but up until the mid-20s, humans haven’t reached their full cognitive capacity. Young children display a significant degree of cognitive inflexibility due to lack of cortical development.

For this reason, children are administered different cognitive flexibility measures such as the A-not-B test (ages 1+), Dimensional Change Card Sorting task (ages 5+), Multiple Classification Card Sorting task (ages 7+), and the Wisconsin Card Sorting task (ages 9 to 11). Adults generally are administered a test too difficult for children to perform called the “Stroop Test.”

Adolescents’ cognitive flexibility continues to improve, and some evidence suggests that they learn faster from negative “reward prediction errors” compared to adults. The ability to learn quicker from reward prediction errors means that they may display heightened cognitive flexibility in certain capacities compared to adults.

Following peak brain development in the mid-20s, it is thought that cognitive flexibility can be maintained and/or enhanced for a long period of time. There is a transition between mid-life adulthood and elderly adulthood in which the cognition declines and neurodegeneration sets in. The elderly tend to have significantly reduced cognitive flexibility compared to younger adults.


Benefits of assessment [ edit | editar fuente]

The most beneficial factor of neuropsychological assessment is that is provides an accurate diagnosis of the disorder for the patient when it is unclear to the psychologist what exactly he/she has. This allows for accurate treatment later on in the process because treatment is driven by the exact symptoms of the disorder and how a specific patient may react to different treatments. Dr. Burke is a psychologist at Brain Therapy Center in Westlake, California who uses neuropsychological assessments to diagnose his patients. His patients usually felt like they wanted to know what was wrong with them even if the prognosis was not good. The assessment allows the psychologist and patient to understand the severity of the deficit and to allow better decision-making by both parties. It is also helpful in understanding deteriorating diseases because the patient can be assessed multiple times to see how the disorder is progressing.

One area where neuropsychological assessments can be beneficial is in forensic cases where the criminal’s competency is being questioned due to possible brain injury or damage. A neuropsychological assessment may show brain damage when neuroimaging has failed. It can also determine whether the individual is faking a disorder (malingering) in order to attain a lesser sentence. Γ]

Neuropsychological assessments usually do not take much time, with most testing completed in 6 to 12 hours or less. This time, however, does not include the role of the psychologist interpreting the data, scoring the test, making formulations, and writing a formal report. Γ]


Ver el vídeo: test de clasificación de tarjetas de Wisconsin (Enero 2022).